lelgenio@lemmy.ml to Memes@lemmy.ml · 2 years agoAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mlimagemessage-square11fedilinkarrow-up1376arrow-down122file-text
arrow-up1354arrow-down1imageAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mllelgenio@lemmy.ml to Memes@lemmy.ml · 2 years agomessage-square11fedilinkfile-text
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
minus-squareapotheotic (she/her)@beehaw.orglinkfedilinkarrow-up6·2 years agoMr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help
Mr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help